Posts

Showing posts from January, 2014

7 April 1960 – ANC and PAC are Banned in South Africa

7 April 1960 – ANC and PAC are Banned in South Africa 1.7 April 1960 – ANC and PAC are Banned in South Africa Description:07-04-2007 · The Unlawful Organisations Act No 34 of 1960 takes effect, allowing the Apartheid government in South Africa to declare unlawful any organization deemed to ... 2.This Day in African History -- ANC and PAC are Banned in South ... Description:07-04-2013 · The Unlawful Organisations Act No 34 of 1960 takes effect on 7 April 1960, allowing the Apartheid government in South Africa to declare unlawful any ... 3.1960 - The O'Malley Archives - Nelson Mandela Description:The government banned the ANC and the PAC, ... 7 April 1960; commencement date ... called for sanctions against South Africa. 14 July 1960. 4.1960 - Nelson Mandela Foundation Description:... 7 April 1960; commencement date ... conservative official estimates placed the membership of the ANC and PAC at 70,000. 6 Apr...
1.#EANF# Description:#EANF# 2.#EANF# Description:#EANF# 3.#EANF# Description:#EANF# 4.#EANF# Description:#EANF# 5.#EANF# Description:#EANF# 6.#EANF# Description:#EANF# 7.#EANF# Description:#EANF# 8.#EANF# Description:#EANF# 9.#EANF# Description:#EANF# 10.#EANF# Description:#EANF#

Léopold Sédar Senghor -- Brief Biography and Image of =?iso-8859-1?Q?L=E9opold_S=E9dar_Senghor?=

Léopold Sédar Senghor -- Brief Biography and Image of Léopold Sédar Senghor 1.Léopold Sédar Senghor -- Brief Biography and Image of ... Description:Léopold Sédar Senghor, first preseident of Senegal, acclaimed poet, writer, teacher and statesman. Co-founder of African philosophical movement known as 'Negritude'. 2.leopold sedar senghor, Description:leopold sedar senghor websites: Currently popular top twenty sites ... #8 Léopold Sédar Senghor-- Brief Biography and Image of ... Léopold Sédar Senghor (1906 ... 3.Astrology: Léopold Sédar Senghor, date of birth: 1906/10/09 ... Description:... Léopold Sédar Senghor, born October 9, ... Biography of Léopold Sédar Senghor. ... In brief, a natal chart is ... 4.leopold senghor, Description:#3 Léopold Senghor Biography ... #8 Léopold Sédar Senghor-- Brief Biography and Image of ... Léo...

A Brief History of Guinea-Bissau

A Brief History of Guinea-Bissau 1.A Brief History of Guinea-Bissau - Part 1 Description:A brief introduction to the history of Guinea-Bissau from the time of early humans to the present day. ... Next: A Brief History of Guinea-Bissau - Part 2 2.A Brief History of Guinea-Bissau - Part 2 Description:A brief introduction to the history of Guinea-Bissau from the time of ... fiscal discipline in the Government of Guinea-Bissau. Previous: A Brief History of ... 3.HISTORY OF GUINEA-BISSAU Description:HISTORY OF GUINEA-BISSAU The Slave Coast Colonial rule ... For a brief period in the 1790s the British attempt to establish a rival foothold on an ... 4.Guinea-Bissau - Wikipedia, the free encyclopedia Description:Guinea-Bissau, officially the ... Main articles: History of Guinea-Bissau and Portuguese Guinea. ... For a brief period in the 1790s, ... 5.History of Guinea-Bissau - Wikipedia, the free encyclopedia Description:History of Guine...
1.#EANF# Description:#EANF# 2.#EANF# Description:#EANF# 3.#EANF# Description:#EANF# 4.#EANF# Description:#EANF# 5.#EANF# Description:#EANF# 6.#EANF# Description:#EANF# 7.#EANF# Description:#EANF# 8.#EANF# Description:#EANF# 9.#EANF# Description:#EANF# 10.#EANF# Description:#EANF#
1.#EANF# Description:#EANF# 2.#EANF# Description:#EANF# 3.#EANF# Description:#EANF# 4.#EANF# Description:#EANF# 5.#EANF# Description:#EANF# 6.#EANF# Description:#EANF# 7.#EANF# Description:#EANF# 8.#EANF# Description:#EANF# 9.#EANF# Description:#EANF# 10.#EANF# Description:#EANF#

Tutankhamun and the Golden Age of the Pharaohs Exhibition: Inlaid Pectoral

Tutankhamun and the Golden Age of the Pharaohs Exhibition: Inlaid Pectoral 1.Tutankhamun and the Golden Age of the Pharaohs: Inlaid Pectoral Description:A gallery of artifacts from the Tutankhamun and the Golden Age of the Pharaohs Exhibition: Inlaid Pectoral. 2.TUTANKHAMUN – And The Golden Age Of Pharaohs Description:28-06-2009 · Thirty years since the Treasures of Tutankhamun set attendance records and changed the face of museum exhibitions, Tutankhamun and the Golden Age of the ... 3.Exhibitions of artifacts from the tomb of Tutankhamun ... Description:A pectoral belonging to Tutankhamun, ... the exhibition; 4 Tutankhamun and the Golden Age of ... and the Golden Age of the Pharaohs exhibition attracted ... 4.Premier Exhibitions - Tutankhamun : King Tut Museum and Exhibit Description:Our exhibition, Tutankhamun: The Golden King and the Great Pharaohs, will show you objects from King Tut, one of the most important rulers in...

Simple Errors in Flash CS6 - ActionScript 3.0 -

this super simple. have created basic replay button in flash cs6 pro, actionscript 3.0. instance name correct, syntax error , '{'expected. doing wrong? code: import flash.events.mouseevent; stop(); playagain_btn.addeventlistener(mouseevent.click, f_playagain); function f_playagain (event:mouseevent):void { gotoandplay(1); } edit: the errors follows: scene=scene 1, layer=actions, frame=1161, line 1 syntax error. scene=scene 1, layer=actions, frame=1161, line 7 '{' expected. i believe removing space in here: f_playagain (event:mouseevent):void might job f_playagain(event:mouseevent):void

mysql - bookshelfJS: idAttribute to specify alternate id name -

i've added idattribute line code in hopes allow me specify alternate name id field: bookshelf.apiuser = bookshelf.model.extend({ tablename: 'users', idattribute: 'userid' }); but breaks node project. long id field named 'id', project works; how can name id field userid , have bookshelfjs know do? the value of idattribute needs column in table. purpose of tell bookshelf column should use id field thing forge , relations. cannot change name of field specifying different name there. way know how change field name in model change actual column name ----- update ---- not cares, can work around issue using virtual , hidden plugins hide actual id attribute , provide virtual 1 different name. first include plugins var bookshelf = require('bookshelf'); bookshelf.plugin('virtuals'); bookshelf.plugin('visibility'); then define model id attribute hidden , virtual attribute get/set id attribute bookshelf.apiuse...

html - Fixed header overlap -

i trying have fixed header site making , content layered beneath header. want have content drawn in under header without user having scroll up. if @ possible user no not see whitespace above content. here made far http://jsfiddle.net/5qwzw/ . <!doctype html> <html lang="en"> <head> <title>elemental fury</title> <meta charset="utf-8" name="discription" content="best game evar!!"> <meta name="viewport" content="width=device-width, user-scalable=no"> <link href="main.css" type="text/css" rel="stylesheet"> <script src="script.js"></script> </head> <body> <center> <nav> <table class="navtable"> <tr> <td align="center" class="navi...

clojure prewalk with select-keys -

(clojure.walk/prewalk #(if (map? %) (select-keys % [:c]) %) {:a 1 :b [{:c 3} {:d 4}] :c 5}) =>{:c 5} why find {:c 5} , not {:c 3} ? i'm trying write pull out key/value pairs exist form , @ level key specify. when function called with {:c 5, :b [{:c 3} {:d 4}], :a 1} ...it returns: {:c 5} ...thus discarding other keys, including :b branch, not traversed.

delphi xe - Copy Email Program to another computer -

i wrote program send email in delphi xe3 , , works fine , when copy program computer (windows 8) works fine on computer (windows 7) stmp.send did not respond unless install embarcadero on .i think problem in files libeay32.dll , ssleay32.dll here code var smtp: tidsmtp; email: tidmessage; sslhandler: tidssliohandlersocketopenssl; begin smtp := tidsmtp.create(nil); email := tidmessage.create(nil); sslhandler := tidssliohandlersocketopenssl.create(nil); try sslhandler.maxlineaction := maexception; sslhandler.ssloptions.method := sslvtlsv1; sslhandler.ssloptions.mode := sslmunassigned; sslhandler.ssloptions.verifymode := []; sslhandler.ssloptions.verifydepth := 0; smtp.iohandler := sslhandler; smtp.host := 'smtp.gmail.com'; smtp.username := 'username@gmail.com'; smtp.usetls := utuseexplicittls; smtp.port := 587; smtp.password := 'password'; smtp.connect; email.clear; email.attachmenten...

java - move a ball one after another -

i writing code of game bean machine(galton box), mechanism 1 ball fall , move randomly until 1 of slots (randomly) , ball comes doing same thing , on, problem balls fall @ same time not want, want each ball fall when current 1 finishes travel..can helps me ! thanks.. here code: import java.awt.*; import java.awt.event.*; import java.util.arraylist; import java.util.collection; import java.util.random; import java.util.scanner; import java.lang.iterable; import javax.swing.*; public class ballpanel extends jpanel { int x=1, y=1; collection <ball> ball; public static void main(string [] args){ // create list swingutilities.invokelater(new runnable() { public void run() { jframe frame= new jframe("bean game"); frame.add(new ballpanel()); frame.setsize(300,500); frame.setlocationrelativeto(null); frame.setdefaultcloseoperation(jframe.exit_on_close); frame.setvisible(true); } }); } public ballpanel() { ...

vb.net - Key gen random number issue -

i in need of random number generator in following format: 65x xxx xxxx ; excluding 1 & 4. final step before im finished first vb.net project. please respond if can help. below currant code works great other not excluding digits. if please edit code ever grateful.. thank you! private sub timer1_tick(byval sender system.object, byval e system.eventargs) handles timer1.tick dim rnd new random dim str1, str2, str3 string str1 = "65" & rnd.next(0, 9) str2 = rnd.next(100, 999) str3 = rnd.next(1000, 9999) listbox1.items.add(str1 & " " & str2 & " " & str3) end sub create 1 random generator instead of creating new 1 on each timer click. random generator seeded value created system clock, if create them close in time generate same series of random numbers. also, creating them @ set interval might produce unwanted patterns in random numbers. private rnd new random you can use function creates random string specific set of...

File location listener in Java - Spring application -

i have java - spring application. want set feature listen file location(folder) , has process file file created in folder. my plan set spring quartz cron job run in every 5 minutes , process files available. please suggest me better approach. a choice of solution depends on how appearance of waited file must detected. if not urgently , @ least 1 minutes ok, solution using kind of cron job ok too. if file should detected asap, must provide permanent running program, detects file in short intervals. can reached task dedicated daemon. if program has nothing during wait time, can contain part file detection.

"Not allowed to load local resource: file:///C:....jpg" Java EE Tomcat -

i'm trying retrieve picture file system after storage,(instead of putting in database copy disc , put path db) i had store picture c:\images\ folder , supposing name complete path c:\images\mypic.jpg when try retrieve set img src attribute <img src="c:\images\mypic.jps"> using java code in browser console found error not allowed load local resource: file:///c://images//mypic.jpg question: how fix these path problem ? should store pictures ? , should retrieve them ? sending tag <img src="c:\images\mypic.jpg"> cause user browser access image filesystem. if have store images in folder located in c:\images suggest create servlet images.jsp, parameter takes name of file, sets servlet response content image/jpg , loads bytes of image server location , put response. but use create application? pure servlet? spring? jsf? here can find info about, how it.

c++ - Get nearest centroid using Thrust library? (K-Means) -

i finished computing distances , stored in thrust vector, instance, have 2 centroids , 5 datapoints , way computed distances each centroid computed distances 5 datapoints first , stored in array , later other centroid in 1d array in distances, this: for (int = 0; < centroids.size(); ++i) { computedistance(data, distances, centroids[i], ndatapoints, ndimensions); } resulting in vector 1d, instance: distancesvalues = {10, 15, 20, 12, 10, 5, 17, 22, 8, 7} datapointsindex = {1, 2, 3, 4, 5, 1, 2, 3, 4, 5} where first 5 values represent centroid 1 , other 5 values centroid 2. what know if there thrust function in can store count in array of minimum values each centroid? comparing values of each index, result should be: counts = {2, 3} where: countofcentroid 1 = 2 countofcentroid 2 = 3 here 1 possible approach: create additional centroid index vector: distancesvalues = {10, 15, 20, 12, 10, 5, 17, 22, 8, 7} datapointsindex = {1, 2,...

java - Handle sqlite database in searching -

in app searchbar there, wheren in user types text. whenever text changes in filed call query db related search items. crashes. here code i'm doing call db @override public boolean onquerytextchange(string newtext) { // todo auto-generated method stub if(newtext.trim().equals("")) { return false; } //showsearchsuggestions(newtext); mfilterdata = mcontroller.get_controllerobj().getdbmanager().getallsuggestedfilter(newtext); if(msearchadapter != null) msearchadapter.swapcursor(mfilterdata); return false; } here how m querying in db manager public cursor getallsuggestedfilter(string filterstring) { string read_query = "select * " + tbl_item_table + " "+ item.title + " like" + "\"%...

fortran - error message in plato -

i new fortran , doing elementary practice. have installed plato latest edition. found program in net, , try compile program dotprod implicit none real :: c real, dimension(3) :: a, b print*,'enter first vector' read*, print*,'enter second vector' read*, b c = a(1)*b(1) + a(2)*b(2) + a(3)*b(3) print*,'dot product = ', c end program dotprod plato shows no sign of error when build , compile, when try run program following error message shows up: executable not exist. can me explain how handle error ? thanks maybe file name long. had same error message, , saved file using shorter name , worked... tried code , works on plato (ftn95 personal edition (ftn95pe) version 7.20) on windows 10.

ios - Comparing times between multiple dates in NSMutableArray NSDateComponent only returns the value of the first date -

basically have array can contain multiple nsmanagedobjects i'm trying sort through these objects , ones have start date want compare time between start date , or start date , end date if set. lastly set timer refresh information in second. the problem having when comparing times time returns value of first object start date. if add value start date time sets 0 , starts on when want add them together. if need more information let me know i using for(object *obj in array) before seemed have more problems int time = 0; if([_ttimes count] != 0){ for(int i=0; < [_ttimes count]; ++i){ ttime *ttime = [_ttimes objectatindex:i]; nslog(@"time%i", i); if(ttime.sdate){ nscalendar *cal = [nscalendar currentcalendar]; nsdate *date = [nsdate date]; if(ttime.edate){ date = ttime.edate; } nsdatecomponents *component = [cal components:nssecondcalendarunit fromdate:ttime.s...

bioinformatics - Generating a mutation frequency on a DNA Strand using Python -

i input dna sequence , make sort of generator yields sequences have frequency of mutations. instance, have dna strand "atgtcgtcacacaccgcagatccgtgtttgac", , want create mutations t->a frequency of 5%. how go creating this? know creating random mutations can done code this: import random def mutate(string, mutation, threshold): dna = list(string) index, char in enumerate(dna): if char in mutation: if random.random() < threshold: dna[index] = mutation[char] return ''.join(dna) but not sure how make fixed mutation frequency. know how that? thanks. edit: so should formatting if i'm using byte array, because i'm getting error: import random dna = "atgtcgtacgtttgacgtagag" def mutate(dna, mutation, threshold): dna = bytearray(dna) #if don't want modify original index in range(len(dna)): if dna[index] in mutation , random.random() < threshold: dna[ind...

c - Struct causing sysMalloc assertion to fail and double free() errors -

i writing simple struct called process, , code seems implemented correctly @ quick glance, upon testing code seems keep crashing program, either sysmalloc assertion failure or double free() error when 1 attempts free it. some relevant code: declaration typedef struct process{ int pid; int background; int group; int status; char* name = 0; } process; constructor process* process_init(char* name, int pid, int group, int background){ process* output = (process*)calloc(1, sizeof(process*)); output->name = name; output->pid = pid; output->group = group; output->background = background; output->status = 0; return output; } calling code char* command = "python"; char* command1= "cat < testing"; process* proc = process_init("command", 1, 1, 1); process* proc2 = process_init("command1", 1, 1, 1); there weird behavior appears work first time aro...

SQL query VBA Access issue -

i error when try execute code, think have problem in sql query , line "service = dlookup ..." can please ! thank much private sub btnconnexion_click() dim categ integer dim service string dim idprof integer dim db dao.database dim qdf dao.querydef dim strsql string set db = currentdb 'vérification que l'utilisater bien entrer e login et le mot de passe me.txtlogin.setfocus if isnull(me.txtlogin) msgbox "svp entrer votre login ", vbinformation, "login required " me.txtlogin.setfocus elseif isnull(me.txtmdp) msgbox "svp entrer votre mots de passe ", vbinformation, "mdp required " me.txtmdp.setfocus else 'vérification que le login et le mdp sont corrects if (isnull(dlookup("login", "dbo_authentification", "login='" & me.txtlogin.value & "'"))) or _ (isnull(dlookup("mdp...

python - TypeError using xml.etree.ElmentTree -

i'm trying test attributes xml file against numbers. when run type() on attributes (in case currentnote ): import xml.etree.elementtree et tree = et.parse('booze.xml') root = tree.getroot() note in root.iter("note"): currentnote = note.get("default-x") print type(currentnote) the type prints <type = 'str'> however, if change last line this: print type(int(currentnote)) i this: typeerror: int() argument must string or number, not 'nonetype' not sure what's going on - seems i'm misunderstanding etree parser returning... currentnote = note.get("default-x") get returns none default if there no match key. you cannot make integer nonetype . in [51]: int(none) --------------------------------------------------------------------------- typeerror traceback (most recent call last) <ipython-input-51-3f3b1d3c7325> in <module>() ----> 1 ...

javascript - Loop elements opacity -

i'm making script fades 3 pictures out in order, pictures' opacity aren't changing. if statements reached pictures not change. first picture changes 1 opacity on page load, don't see why wouldn't work in function. window.onload = function() { document.getelementbyid("img1").style.opacity = 1; setinterval(swappictures, 2000); }; var swappictures = function(){ if(typeof swappictures.img1v === 'undefined'){ swappictures.img1v = true; } if(typeof swappictures.img2v === 'undefined'){ swappictures.img2v = false; } if(typeof swappictures.img3v === 'undefined'){ swappictures.img3v = false; } if(swappictures.img1v && !swappictures.img2v && !swappictures.img3v){ swappictures.img1v = !swappictures.img1v; swappictures.img2v = !swappictures.img2v; document.getelementbyid("img1").style.opacity = .4; document.getelementbyid("imgtwo...

c# - FetchData using DotNetOpenAuth? -

Image
i have implemented this simple code described here ( vs 2010 , webforms) protected void page_load(object sender, eventargs e) { var openid = new openidrelyingparty(); var response = openid.getresponse(); if (response != null && response.status == authenticationstatus.authenticated) { formsauthentication.redirectfromloginpage(response.claimedidentifier, false); } } click function : protected void btngoogle_click(object sender, imageclickeventargs e) { using (openidrelyingparty openid = new openidrelyingparty()) { var request = openid.createrequest("https://www.google.com/accounts/o8/id"); request.redirecttoprovider(); } } question #1 when click login ( via google) opens this consent screen : but how come works ? thought have create api key in google developer console in order allow people login. ( like did here other app of myne-> ) obviously didn't create any " localhost " app. how still work...

java - how to implement @GeneratedValue with my own strategy for generating keys -

i want implement own strategy generating primary keys new rows in table, example want id of host 172.24.85.20 8520. can somehow extend @generatedvalue annotation? approach recommend? 10x in advance! gal in projects i'm using custom key, because need entities unique identity before persist() called. solution not using @generatedvalue annotation, initialize id-field manually. @generatedvalue annotation depends on database , primary key provider it. in case id field calculated , set before calling entitymanager.persist() or step can handled in @prepersist annotated entitylistener method ( http://www.java2s.com/tutorial/java/0355__jpa/entitylistenerpreupdate.htm ). apart extending annotations not possible ( why not possible extend annotations in java? ); combine annotations using stereotypes or create own annotations.

dataframe - Extracting a row from a data frame in R -

let's have matrix this: > = matrix( + c(2, 4, 3, 1, 5, 7), # data elements + nrow=2, # number of rows + ncol=3, # number of columns + byrow = true) # fill matrix rows > # print matrix [,1] [,2] [,3] [1,] 2 4 3 [2,] 1 5 7 now, used small example, imagine if matrix bigger, 200 rows , 5 columns etc. want do, minimum value column 3, , extract row. in other words, find , row 3rd attribute lowest in entire column of data frame. datatoreturn <- which(a== min(a[, 3]) but doesn't work. another way use which.min a[which.min(a[, 3]), ] ##[1] 2 4 3

link to - Rails 4 - Link_to action create with params -

i add link rails app allow users "like" resource (property) directly. click on link add db without asking user. the like table: user_id , property_id as can see, user_id , property_id have in link_to params. routes.rb: resources :likes resources :properties index: <%= link_to "like property", new_like_path(current_user, property.id) %> #does not work idea controller: def new @like = like.new end def create @like = like.new(like_params) respond_to |format| if @like.save format.html { redirect_to @like, notice: 'like created.' } format.json { render action: 'show', status: :created, location: @like } else format.html { render action: 'new' } format.json { render json: @like.errors, status: :unprocessable_entity } end end end so in properties#index , call create method add on property. index:- <%= link_to "like propert...

exception - Jersey: How to register MultiPartConfigProvider class -

i'm trying load multiple files jersey, demands me configuration can't find. dependency, had add because jersey couldn't resolver type "multipart/related": <dependency> <groupid>org.glassfish.jersey.media</groupid> <artifactid>jersey-media-multipart</artifactid> <version>2.7</version> </dependency> this api use multipart: @put @consumes("multipart/related") @path("/{id}/user/{userid}") public response loadfile(@pathparam("id") int id, @pathparam("userid") int userid, multipart files) throws exception{ int resultado = tool.loadfile(id, userid, files); switch (resultado){ case 401: return response.status(401).entity("no existe el experimento con id: "+id).build(); case 402: return response.status(402).entity("el tipo de uno de los archivos no se encuentra en los tipos de entregables del expe...

sublimetext3 - Vim like jump-to-word in Sublime Text -

i'm not familiar vim, there's particular feature like. the / search command. type / , string of text, ex: /text , cursor moved beginning of first occurrence of word. sublime text has ctrl+; that's not i'm looking for, selects words , doesn't start cursor is. is there sublime text, either plugin or keybinding missed? i found package right. it's on package control , it's called jumpto use ctrl+e (i rebound ctrl+shift+/ because of emmets ctrl+e binding) start searching. works perfectly. if want select word wel, use ctrl+shift+e edit: actually, no it's not same, searches in current line of text. make current cursor position to end of file, source , line line = self.view.substr(sublime.region(pt, lr.b)) (line 27) and replace with line = self.view.substr(sublime.region(pt, self.view.size()))

SELECT ST_INTERSECTS('geometry', POLYGON(KML?)) with google Fusion Tables -

i've seen st_intersects can call... st_intersects('geometry', circle(latlng(lat,lng),1)) how write if want have polygon instead? st_intersects('geometry', polygon( outerboundaryis( latlng(lat,lng),latlng(lat,lng)),(..next shape) ))) or can use kml in way? st_intersects('geometry', '<multigeometry><polygon> <tessellate>1</tessellate><extrude>0</extrude> <altitudemode>clamptoground</altitudemode> <outerboundaryis><linearring> <coordinates>lats,lngs</coordinates> </linearring></outerboundaryis></polygon></multigeometry>') thanks! quince answer(wouldn't let me post yet): figured par out. select 'name' 1vvuotygcnlbxmd66lzehj81-tbgpiykpvmxazxyh st_intersects('geometry', polygon( latlng(40.249528, -120.8435), latlng(40.258326, -121.061249), latlng(40.301765, -121.007911), latlng(40.249528, -120.8435) )) you can...

contourf - putting together 2 contours in matlab. -

i'm making own shakemap (so far, shamemap) matlab. shakemap representation of intensity of ground shaking in map (google more info). want similar usgs, in plot intensity using jet colormap , control shading represent altimetry data. far haven't figured out how this. i have set of coordinates location's elevation (from nasa's srtm) , in same set of coordinates have parameters of ground shaking. [lat long srtm] [lat long groundshaking] i can contour them separately, if put them in same figure 1 overrides other. how can put them in same figure? have thought assigning new value each location such new value accounts both measures; locations same groundshaking parameter should same color, if 1 higher 1 should darker. unfortunately don't know how implement this. have thought setting alpha feature manualy, can't make work ground shaking data. suggestions ? mwe: x=0:0.01:1; y=0:0.01:1; [xx,yy]=meshgrid(x,y); asd1=zeros(length(x),length(y)); ads2=asd1;...

javascript - OnMouseOver / OnMouseOut -

i'm using onmouseover , onmouseout function change colour of social media icons in footer of wordpress website: http://www.retelevise.com . it works fine, i'm using snippet of javascript link email address (i read somewhere way hide address spammers?) – javascript doesn’t seem mouse function. <script type="text/javascript"> <!-- var addr1 = "mailto:" var addr2 = "info" var addr3 = "@" var addr4 = "retelevise" var addr5 = ".com" document.write('<a href="' + addr1 + addr2 + addr3 + addr4 + addr5 + '">') document.write('<img src="http://www.retelevise.com/wp-content/themes/myownzee/branding/socialmedia-email-1.png" onmouseover="this.src='http://www.retelevise.com/wp-content/themes/myownzee/branding/socialmedia-email-2.png'" onmouseout="this.src='http://www.retelevise.com/wp-content/themes/myownz...

javascript - PhantomJS stops screen capture on js error, but page renders fine in browser -

how can make phantomjs continue screen capture after encountering js error on page? page renders correctly in browsers, not in phantomjs screen capture. 1 page works, 1 page fails: phantomjs fails capture graph on page: https://www.graf.ly/user_graphs/510 . phantomjs successful on page: https://www.graf.ly/user_graphs/505 . error: it seems phantomjs encounters errors on page , stops capturing. run rasterize.js script phantomjs's tutorial debug mode on error on failed page: typeerror: 'undefined' not function (evaluating 'function(e){this.visible=true;this.update(e)}.bind(this)') https://cdnjs.cloudflare.com/ajax/libs/rickshaw/1.4.6/rickshaw.min.js:2 https://cdnjs.cloudflare.com/ajax/libs/rickshaw/1.4.6/rickshaw.min.js:2 https://cdnjs.cloudflare.com/ajax/libs/rickshaw/1.4.6/rickshaw.min.js:1 in klass https://www.graf.ly/graph_templates/55/graph.js:278 https://www.graf.ly/graph_templates/55/graph.js:11 https://www.graf.ly/graph_templates...

scala - Why does this immutable doubly linked list implementation overflow the stack -

as exercise thought i'd try , implement immutable doubly linked list in scala. @ moment lazy val s causing stack overflow. can explain why happening? i'm pretty sure recursive function terminate, length of 3 small number create overflow terminating function. seems laziness means it's getting stuck in loop somewhere. class node(val prev: option[node], val next: option[node], val id: int){ override def tostring = "["+id+"] "+next.tostring } def addnodes(nnodes: int, last: node): node = { if(nnodes > 0){ lazy val newnode: node = new node(some(last), some(addnodes(nnodes-1, newnode)),nnodes) newnode } else { new node(some(last), none, nnodes) } } def doublylinked(n:int) = { lazy val list: node = new node(none, some(addnodes(n-2, list)),n-1) list } val x = doublylinked(3) println(x) the problem here not addnodes , it's lazy val itself. lazy val newnode: node = new node(some(last), some(addnodes...

What is the correct way to input # in a markdown -

i don't know if correct place ask question. actually question simple. how input # in markdown document. because # interpreted else, example, header. have no way input character '#' itself. can tell me how so? thanks escape '\' such characters - i.e. \# - see here

javascript - AngularJS and REST resources naming wondering -

so in angular js app in service called 'authservice' have following resources: var userarealogin = $resource('/api/user_area/login'); var userareasignup = $resource('/api/user_area/signup'); var session = $resource('/api/user_area/getsession'); var userarealogout = $resource('/api/user_area/logout'); but doesn't feel quite right, i'm using methods, example: this.login = function(credentials) { var user = userarealogin.get(credentials, function() { ... }); }; this.signup = function(userinfo) { var signup = userareasignup.get(userinfo, function() { ... }); }; i'm confused resources use, should have this? var session = $resource('/api/user/session'); var userarea = $resource('/api/user'); userarea.get(credentials); //should login user? userarea.post(credentials); //should signup user? session.delete(); //should logout user? session.get(); //should sessions of logged user if ...

access vba - what is the VBA for the USING statement -

in csharp or vb.net use using statement reasons know: 1 can open database , close automatically without writing explicitly. samething in vba how it? are vb.net statement/keywords/ available in vba ? how tell if given statement is(was) known in vba ? there library(glosary) of vba statements/keyword/operators ? c# using(var db=new mydbcontext()){ //do work here } vb.net using s = new mydbcontext() '--..do work here end using answering first question, you've hinted, using syntactic sugar calling dispose() on object instance implements idisposable interface. it equivalent to dim s mydbcontext try s = new mydbcontext() // ... s.dispose() end try since vba doesn't support using sugar, , in absence of structured try..catch exception handling, you'll need explicitly call dispose() on paths control lifespan of object ( mydbcontext in case). in case may have used .close()

java - where to learn Trigger Development for IBM® OpenPages® GRC Framework -

i've been asked company learn trigger development ibm® openpages® grc framework. i have read trigger developer guide provided ibm. more focused on concepts not tell how start (meaning setting development environment). i have no idea start , there no on internet. how should start learning trigger development. i trained in company ibm consultant ibm® openpages® grc framework. however, seems me there @ point in time no "free/open" guides available. one of "open" guides paper pointed out. however, ibm provides lot of trainings , support ibm® openpages® grc framework, therefore suggest contact, customer support or ask in company training on framework. hope help! br.

android - Flash path to AndroidSDK ADB tool -

i'm new app-developing , i'm creating android app flash cs5.5. on http://help.adobe.com/en_us/air/build/ws901d38e593cd1bac-2ae4ef8612b2d078909-8000.html adobe says have "enter path adb tool in tools subdirectory of android sdk", in the deployment tab of air android settings. problem open tab, place enter path isn't there. so, have skipped step?? in advance the problem open tab, place enter path isn't there. i same situation in flash cs6. have created application android without specifying path adb tool. suppose flash have own internal instance of adb tool just in case adb tool on computer situated here: c:\program files\adt-bundle\sdk\platform-tools\adb.exe

blackberry - Datefield not editable -

i'm using j2me polish 2.1.2 , trying add net.rim.device.api.ui.component.datefield blackberry tableitem. displays correctly, after setting editable, can't change on it. has else had experience? this = tableitem tfinput = new datefield(_meta.title, system.currenttimemillis(), mode); //#style textinputcell this.set(0, 0, tfinput); this.setselectionmode(tableitem.selection_mode_cell); edit: reason doing because of issues datefield.time inputmode on blackberry if use j2me polish's datefield. workaround problem extend j2me polish's datefield , intercept when setting mode time follows : public class mydatefield extends datefield{ public mydatefield (string title, int mode){ super(title, mode); // blackberry has bug in time mode, going date time instead , formatting date if (mode == datefield.time){ super.setinputmode(datefield.date_time); super.setdateformatpattern("hh:mm"); ...

eclipse - Worklight Skin deployment Issue -

Image
i using worklight skin recent project ios hybrid application. created skins ipad retina. when deploying first time project skin folder time not getting error after deploy project again throwing error. *if deploy project without skin folder @ time it's working fine. request please suggest working approch. failed deploy application worklight server: inputstream error: java.lang.outofmemoryerror: java heap space thanks, amitesh namdev try solution provided in following question java heap space: how increase java heap space in worklight server? for me error related heap size of server, not heap size of eclipse. on server view, expand worklight server , select jvm options, add (for example) -xmx1024m

javascript - MVC: Submit on TextBox change -

i have textbox on mvc 4 view, , let user press enter on changing text , call controller's action method. thanks. here part of view: @using (html.beginform()) { <div class="editor"> @html.labelfor(m => m.folderpath) @html.textboxfor(m => m.folderpath, new { @id = "folderpath", @style="width:500px;" }) @html.validationmessagefor(m => m.folderpath) </div> and part of controller: [httppost] [multiplebutton(name = "action", argument = "refresh")] public actionresult refresh(edifilemodel edifilemodel) { if (directory.exists(edifilemodel.folderpath)) { folderpath = edifilemodel.folderpath; } else { modelstate.addmodelerror("folderpath", "this folder not exist!"); } edifilemodel = load(); return view("index", edifilemodel); } add submit button... <input type="submit" value="sub...

asp.net - How to create multiple code behind file for .aspx page -

i have situation need create multiple code behind files single .aspx page in c# asp.net. have web form on huge coding done , need multiple developer's working on simultaneously. how can achieve same? here code snippet tried class 1 mypartialclass.cs namespace webapplication1 { public partial class default : system.web.ui.page { protected void printtext(string pt) { response.write(pt); //lbltest.text = pt; //can not access label in partial class. } } } class 2 default.aspx.cs namespace webapplication1 { public partial class default : system.web.ui.page { protected void page_load(object sender, eventargs e) { printtext("hello world"); } } } and html source <%@ page language="c#" autoeventwireup="false" codebehind="default.aspx.cs" inherits="webapplication1.default" %> <!doctype html> <html x...